Copyright: Eurokinissi

Πανελλαδικές εξετάσεις 2020: Οι απαντήσεις στη Βιολογία

Τελευταία Ενημέρωση
Για πρώτη φορά οι μαθητές αντιμετώπισαν από κοινού τη Βιολογία Προσανατολισμού και τη Βιολογία Γενικής Παιδείας

Στη Βιολογία και στην Κοινωνιολογία εξετάστηκαν σήμερα, Παρασκευή 19 Ιουνίου, οι υποψήφιοι των πανελληνίων εξετάσεων από τα ΓΕΛ. Το ethnos.gr θα δημοσιεύει τις απαντήσεις των θεμάτων των πανελλαδικών εξετάσεων σε συνεργασία με το «Νέο Φροντιστήριο» και την ομάδα των καθηγητών του. 

 

Σχολιασμός των θεμάτων του μαθήματος της Βιολογίας από την ομάδα των Βιολόγων του Νέου Φροντιστηρίου

Μετά από μια ιδιαίτερη χρονιά, από πολλές απόψεις, οι υποψήφιοι κλήθηκαν σήμερα να αντιμετωπίσουν το μάθημα της Βιολογίας... Φέτος, για πρώτη φορά οι μαθητές αντιμετώπισαν από κοινού τη Βιολογία Προσανατολισμού και τη Βιολογία Γενικής Παιδείας..

Τα θέματα, αν και παρουσίαζαν κλιμακωτή δυσκολία και αρκετή έκταση, κινούνται στα όρια του αναμενόμενου και η αρχική εκτίμηση είναι πως οι καλά προετοιμασμένοι υποψήφιοι μπορούν να ανταποκριθούν ικανοποιητικά..

Οι ερωτήσεις πολλαπλής επιλογής του πρώτου θέματος απαιτούσαν γνώση από την πλευρά των μαθητών και κατανόηση του υλικού και των δύο βιβλίων, χωρίς όμως να παρουσιάζουν κάποια ιδιαίτερη δυσκολία.

Στο δεύτερο θέμα οι ερωτήσεις θεωρίας, προερχόμενες από την ύλη και των δύο βιβλίων, κρίνονται αναμενόμενες και με απαντήσεις σχετικά μικρής έκτασης...

Στο τρίτο θέμα ο βαθμός δυσκολίας ανεβαίνει.. Η ερώτηση διαγράμματος αντιγόνου και η άσκηση 2ου κεφαλαίου από το βιβλίο της Γενικής δεν αποτελούν έκπληξη. Τα ερωτήματα Γ3 και Γ4, από την ύλη του Προσανατολισμού, απαιτούν κάποια προσοχή παραπάνω...Καλή και σε βάθος κατανόηση της εκφώνησης, γνώση και κριτική ικανότητα από την πλευρά των υποψηφίων θεωρούνται απαραίτητα για την ολοκληρωμένη απάντηση αυτών των υποερωτημάτων...

Τέλος, το τέταρτο θέμα αποτελεί ίσως την μόνη «πρόκληση» των σημερινών θεμάτων…Τα υποερωτήματα του συγκεκριμένου θέματος απαιτούσαν σε βάθος γνώση, απόλυτη κατανόηση και συνδυαστική σκέψη από την πλευρά των υποψηφίων. Ήταν το θέμα που απαιτούσε τον περισσότερο χρόνο και αυτό που ανεβάζει τον πήχη της δυσκολίας των φετινών θεμάτων λίγο παραπάνω από τα αντίστοιχα των περσινών εξετάσεων...

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

EΠΙΜΕΛΕΙΑ ΑΠΑΝΤΗΣΕΩΝ: ΓΙΩΤΑ ΠΑΠΠΑ, ΑΝΤΩΝΗΣ ΒΥΛΛΙΩΤΗΣ, ΓΙΩΡΓΟΣ ΖΩΗΣ, ΒΕΛΙΣΣΑΡΙΟΣ ΚΥΤΡΙΔΗΣ

ΘΕΜΑ Α

A1. B

A2. A

A3 . Δ

Α4. Α

Α5. Γ

Β1.

 

Αριθμός Χρωμοσωμάτων

Αριθμός μορίων DNA πυρήνα

Μετάφαση μίτωσης

48

96

Θυγατρικό κύτταρο που προκύπτει από την Μείωση Ι

24

48

Β2.

Σελ 63 Γενικής

Το πεπτικό σύστημα επιβαρύνεται επίσης, καθώς το οινόπνευμα προκαλεί αύξηση των εκκρίσεων του στομάχου και στη συνέχεια φλεγμονή. Παράλληλα, η υπερβολική κατανάλωση οινοπνεύματος ελαττώνει την ικανότητα του λεπτού εντέρου να απορροφά τις θρεπτικές ουσίες που περιέχονται στην τροφή μας. Συνέπεια του γεγονότος αυτού είναι η φθορά του ήπατος, το οποίο, αντί να αποθηκεύει τις πρωτεΐνες και τους υδατάνθρακες που χρησιμοποιούνται από τα ηπατικά κύτταρα, αποθηκεύει λίπη, με αποτέλεσμα τη διόγκωσή του. Η συνεχιζόμενη κατανάλωση οινοπνεύματος από έναν αλκοολικό καταλήγει συχνά σε εκφυλισμό του ηπατικού ιστού, μια κατάσταση που ονομάζεται κίρρωση του ήπατος, η οποία, αν και δεν περιορίζεται στους αλκοολικούς, παρουσιάζεται ωστόσο σε ποσοστό οκτώ φορές μεγαλύτερο σ’ αυτούς παρά στα μη εξαρτημένα από το αλκοόλ άτομα. Η κατάχρηση του αλκοόλ προκαλεί υπέρταση και έτσι αυξάνει τις πιθανότητες για την εμφάνιση καρδιαγγειακών νοσημάτων. Το αλκοόλ όμως συσχετίζεται και με την αύξηση της πιθανότητας να εκδηλωθούν διάφορες μορφές καρκίνου (στομάχου, ήπατος, πνευμόνων), ενώ σε συνδυασμό με τη νικοτίνη ευθύνεται για καρκίνους του λάρυγγα και του οισοφάγου.

Β3.

  1. Σελ 13-14 Γενικής

Τα βακτήρια αναπαράγονται κυρίως μονογονικά με απλή διχοτόμηση. Η αναπαραγωγή τους διαρκεί μικρό χρονικό διάστημα. Ορισμένα βακτήρια, σε ευνοϊκές γι’ αυτά συνθήκες, διαιρούνται κάθε 20 λεπτά. Σε αντίξοες συνθήκες, όπως σε ακραίες θερμοκρασίες ή υπό τη δράση ακτινοβολιών, πολλά βακτήρια μετατρέπονται σε ανθεκτικές μορφές, τα ενδοσπόρια. Τα ενδοσπόρια είναι αφυδατωμένα κύτταρα με ανθεκτικά τοιχώματα και χαμηλούς μεταβολικούς ρυθμούς. Όταν οι συνθήκες του περιβάλλοντος ξαναγίνουν ευνοϊκές, τα ενδοσπόρια βλαστάνουν δίνοντας το καθένα ένα βακτήριο.

  1. Οι μηχανισμοί με τους οποίους ένα κύτταρο «ξυπνά» ένα «κοιμισμένο» γονίδιο είναι οι πιο σημαντικοί και πολύπλοκοι της Μοριακής Βιολογίας. Οι αρχικές μελέτες της ρύθμισης των γονιδίων έγιναν από τους Jacob και Monod, το 1961. Οι ερευνητές περιέγραψαν την ικανότητα του βακτηρίου Ε. coli να παραγάγει τα τρία απαραίτητα ένζυμα που χρειάζεται για να μεταβολίσει το δισακχαρίτη λακτόζη, όταν δεν υπάρχει γλυκόζη στην τροφή του. Οι Jacob και Monod απέδειξαν με γενετικές μελέτες ότι τα γονίδια που κωδικοποιούν τα τρία αυτά ένζυμα βρίσκονται το ένα δίπλα στο άλλο πάνω στο γονιδίωμα του βακτηρίου και αποτελούν μια μονάδα, που την ονόμασαν οπερόνιο της λακτόζης. Σε αυτό περιλαμβάνονται εκτός από αυτά τα γονίδια, που ονομάζονται δομικά, και αλληλουχίες DNA που ρυθμίζουν τη μεταγραφή τους. Οι αλληλουχίες αυτές που βρίσκονται μπροστά από τα δομικά γονίδια είναι κατά σειρά ένα ρυθμιστικό γονίδιο, ο υποκινητής και ο χειριστής. Το οπερόνιο της λακτόζης δε μεταγράφεται ούτε μεταφράζεται, όταν απουσιάζει από το θρεπτικό υλικό η λακτόζη. Τότε λέμε ότι τα γονίδια που το αποτελούν βρίσκονται υπό καταστολή. Πώς επιτυγχάνεται η καταστολή; Δύο είναι τα ρυθμιστικά μόρια: μια αλληλουχία DNA, που ονομάζεται χειριστής και βρίσκεται μεταξύ του υποκινητή και του πρώτου γονιδίου, και μια ρυθμιστική πρωτεΐνη-καταστολέας. Όταν στο θρεπτικό υλικό υπάρχει μόνο λακτόζη, τότε ο ίδιος ο δισακχαρίτης προσδένεται στον καταστολέα και δεν του επιτρέπει να προσδεθεί στο χειριστή. Τότε η RNA πολυμεράση είναι ελεύθερη να αρχίσει τη μεταγραφή. Δηλαδή η λακτόζη λειτουργεί ως επαγωγέας της μεταγραφής των γονιδίων του οπερονίου. Τότε τα γονίδια αρχίζουν να «εκφράζονται», δηλαδή να μεταγράφονται και να συνθέτουν τα ένζυμα. Τα τρία ένζυμα μεταφράζονται ταυτόχρονα από το ίδιο μόριο mRNA το οποίο περιέχει κωδικόνιο έναρξης και λήξης για κάθε ένζυμο (Εικόνα 2.13β). Συμπερασματικά, η ίδια η λακτόζη ενεργοποιεί τη διαδικασία για την αποικοδόμησή της. Όταν η λακτόζη διασπαστεί πλήρως, τότε η πρωτεΐνη καταστολέας είναι ελεύθερη να προσδεθεί στο χειριστή και να καταστείλει τη λειτουργία των τριών γονιδίων.
  2. Στο γονιδίωμα των προκαρυωτικών οργανισμών τα γονίδια των ενζύμων που παίρνουν μέρος σε μια μεταβολική οδό, όπως η βιοσύνθεση διάφορων αμινοξέων, οργανώνονται σε οπερόνια, δηλαδή σε ομάδες που υπόκεινται σε κοινό έλεγχο της έκφρασής τους.

Β4. Ο αλφισμός οφείλεται στην έλλειψη ενός ενζύμου, το οποίο είναι απαραίτητο για το σχηματισμό της χρωστικής μελανίνης. Στα άτομα που πάσχουν από αλφισμό υπάρχει έλλειψη της χρωστικής στο δέρμα, στα μαλλιά και στην ίριδα του οφθαλμού. Ο αλφισμός εμφανίζει ετερογένεια, δηλαδή άλλα άτομα εμφανίζουν παντελή έλλειψη ενεργότητας του ενζύμου, ενώ άλλα εμφανίζουν μειωμένη ενεργότητα.

Είναι γνωστό ότι στα διπλοειδή κύτταρα υπάρχουν δύο αλληλόμορφα για μία ορισμένη γενετική θέση, ενώ ένα απλοειδές κύτταρο, όπως ένας γαμέτης, έχει μόνο ένα. Εντούτοις, εάν εξετάσουμε έναν πληθυσμό ατόμων μπορεί να βρούμε περισσότερα από δύο αλληλόμορφα για μία γενετική θέση. Εάν στον πληθυσμό υπάρχουν τρία ή περισσότερα αλληλόμορφα για μία γενετική θέση, τότε αυτά ονομάζονται πολλαπλά αλληλόμορφα. Πολλά γονίδια που ευθύνονται για τη δημιουργία ασθενειών έχουν πολλαπλά αλληλόμορφα γονίδια, όπως συμβαίνει στη β-θαλασσαιμία. Συνήθως κάθε αλληλόμορφο του φυσιολογικού γονιδίου σχετίζεται με διαφορετική μορφή της ίδιας ασθένειας, ήπια ή σοβαρή.

Β5.

Αμετάφραστες περιοχές

Κωδικόνιο λήξης

Γονίδια tRNA

Γονίδια rRNA

Γ1.

Β: Πρωτογενής ανοσοβιολογική απόκριση

Α: Πρωτογενής ανοσοβιολογική απόκριση

Γ: Δευτερογενής ανοσοβιολογική απόκριση

 

 

pyramides-1.jpg

 Γ3.

1η περίπτωση: Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α βρίσκεται στο μιτοχονδριακό DNA.

Στη περίπτωση αυτή θα πάσχουν όλοι οι απόγονοι του ζευγαριού διότι το ζυγωτό των ανώτερων οργανισμών περιέχει μόνο τα μιτοχόνδρια που προέρχονται από το ωάριο, επομένως, η προέλευση των μιτοχονδριακών γονιδίων είναι μητρική.

2η περίπτωση: Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α βρίσκεται στο πυρηνικό DNA.

Με δεδομένο ότι η συχνότητα εμφάνισης της ασθένειας είναι ίδια τα αρσενικά και στα θηλυκά άτομα του πληθυσμού συμπεραίνουμε ότι ο τρόπος κληρονόμησης δεν είναι φυλοσύνδετος.

Α) Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α είναι αυτοσωμικό υπολειπόμενο.

Α: Επικρατές αλληλόμορφο γονίδιο υπεύθυνο για την μη παραγωγή της φυσιολογικής πρωτεϊνης Α.

α: Υπολειπόμενο αλληλόμορφο γονίδιο υπεύθυνο για την παραγωγή της φυσιολογικής πρωτεϊνης Α.

Γυναίκα: ΑΑ ή Αα

Άνδρας: αα

Πιθανότητα οι απόγονοι να πάσχουν είναι 100% και 50% αντίστοιχα.

Β) Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α είναι αυτοσωμικό επικρατές.

Α: Επικρατές αλληλόμορφο γονίδιο υπεύθυνο για την παραγωγή της φυσιολογικής πρωτεϊνης Α.

α: Υπολειπόμενο αλληλόμορφο γονίδιο υπεύθυνο για την μη παραγωγή της φυσιολογικής πρωτεϊνης Α.

Γυναίκα: αα

Άνδρας: ΑΑ ή Αα

Πιθανότητα οι απόγονοι να πάσχουν είναι 0% και 50% αντίστοιχα.

 

Γ4.

Μετά από 3 κύκλους αντιγραφής θα υπάρχουν συνολικά 8 αντίγραφα του αρχικού μορίου DNA, εκ των οποίων τα 6 θα αποτελούνται αποκλειστικά από ραδιενεργό 15Ν. Είναι γνωστό πως μετά το πέρας της αντιγραφής ενός μορίου DNA τα δύο θυγατρικά μόρια που προκύπτουν είναι πανομοιότυπα με το μητρικό και καθένα αποτελείται από μία παλιά και μία καινούρια αλυσίδα. Ο μηχανισμός αυτός ονομάζεται ημισυντηρητικός. Επομένως το ποσοστό μορίων που θα περιέχουν αποκλειστικά 15Ν θα είναι τα 6/8 δηλαδή το 75% των μορίων.

 

ΘΕΜΑ Δ Δ1. Γονίδιο Α mRNA 5’ GAAUUCGGAACAUGCCCGGGUCAGCCUGAGAGAAUUCCC 3’

Δ2. Γονίδιο Γ Εφόσον το tRNA μεταφέρει μεθειονίνη διαθέτει αντικωδικόνιο 3’UAC 5’ συμπληρωματικό ως προς το κωδικόνιο 5’ AUG3’ της μεθειονίνης. Άρα, η μη μεταγραφόμενη αλυσίδα του γονιδίου που κωδικοποιεί το συγκεκριμένο tRNA πρέπει να περιλαμβάνει την τριάδα 5’CAT3’.

Δ3. Γονίδιο Β Εφόσον, το mRNA διαθέτει την αλληλουχία 5’GGAAC 3’ στην 5’ αμετάφραστη περιοχή του, το rRNA πρέπει να διαθέτει στην αλληλουχία του την πεντάδα 3’ CCUUG 5’. Άρα, το γονίδιο που κωδικοποιεί το συγκεκριμένο rRNA πρέπει να διαθέτει στη μεταγραφόμενη αλυσίδα του την πεντάδα 5’ GGAAC 3’.

Δ4. i) ΠΕ-Ι η οποία τέμνει το πλασμίδιο και EcoRI που απομονώνει το γονίδιο. ii) 5’ CAATTC …………………….GAATTG 3’ 3’ GTTAAG……………………..CTTAAC 5’ iii) Το ανασυνδυασμένο πλασμίδιο δεν διαθέτει την αλληλουχία αναγνώρισης της ΠΕ-Ι...Άρα, το ένζυμο αυτό δεν επιδρά.

 

Δείτε εδώ τα θέματα των εξετάσεων:

Κοινωνιολογία

Βιολογία

Με το παλαιό σύστημα

Βιολογία Γενικής Παιδείας - Ημερήσια

Βιολογία Γενικής Παιδείας - Εσπερινά

Ακολουθούν την επόμενη εβδομάδα, η εξέταση στη Φυσική στις 22 Ιουνίου και στις 24 Ιουνίου στην Ιστορία και την Πληροφορική. Το πρόγραμμα ολοκληρώνεται με την εξέταση στις 26 Ιουνίου στην Χημεία (ΟΠ Θετικών Σπουδών και Σπουδών Υγείας) και την Οικονομία (ΟΠ Σπουδών Οικονομίας και Πληροφορικής).

Νέο Φροντιστήριο: 52 χρόνια επιτυχίες

Ο όμιλος Νέο Φροντιστήριο, ιδρύθηκε το 1968 & σήμερα  αριθμεί πάνω από 80 εκπαιδευτικά κέντρα με 600 καθηγητές, 100 συνεργάτες διευθυντές σπουδών κάθε ειδικότητας, πλήρη σειρά εκδόσεων και πλούσιο ηλεκτρονικό εκπαιδευτικό υλικό. Η πλούσια ακαδημαϊκή του παράδοση διατηρείται αναλλοίωτη, αφού οι άνθρωποι του βρίσκονται σε συνεχή εγρήγορση αφουγκραζόμενοι τις νέες εξελίξεις & προκλήσεις της εποχής, κάτι που επιβεβαιώθηκε περίτρανα στην πρόσφατη περιπέτεια της πανδημίας.   Η  διαχρονική πρωτοκαθεδρία του οργανισμού στην προετοιμασία των μαθητών για την τριτοβάθμια εκπαίδευση, ανεξαρτήτως του τρόπου εισαγωγής τους, καταδεικνύεται από τα αποτελέσματα, αφού κάθε χρόνο πάνω από 1200 μαθητές των  φροντιστηρίων μας εισάγονται στην Τριτοβάθμια Εκπαίδευση. Υπολογίζεται ότι πάνω από 60000 σημερινοί επιστήμονες πέρασαν από τα θρανία του όλα αυτά τα χρόνια!

Για περισσότερες πληροφορίες επισκεφθείτε το https://neo.edu.gr/

ΚΑΤΕΒΑΣΤΕ ΤΟ ΝΕΟ APP ΤΟΥ ΕΘΝΟΥΣ Ethnos.gr - App Store Ethnos.gr - Google Play
ΣΧΟΛΙΑ <% totalComments %>
ΞΕΚΙΝΗΣΤΕ ΤΗ ΣΥΖΗΤΗΣΗ

Tο ethnos.gr δημοσιεύει κάθε σχόλιο το οποίο είναι σχετικό με το θέμα. Ωστόσο, αυτό δεν σημαίνει ότι υιοθετεί τις απόψεις αυτές. Διατηρεί το δικαίωμα να μην δημοσιεύει συκοφαντικά, υβριστικά, ρατσιστικά ή άλλα σχόλια που προτρέπουν σε άσκηση βίας. Επίσης, σχόλια σε greeklish και κεφαλαία δεν θα δημοσιεύονται ενώ το ethnos.gr, όταν και όπου κρίνει, θα συμμετέχει στον διάλογο.

Δείτε εδώ τους όρους χρήσης.

Προσθήκη Σχολίου
<% replyingComment.name %>
Ακύρωση
Το σχόλιό σας έχει προωθηθεί για έγκριση
Αυτός ο ιστότοπος προστατεύεται από το reCAPTCHA και ισχύουν η Πολιτική Απορρήτου και οι Όροι Παροχής Υπηρεσιών της Google.

NETWORK

ΤΕΛΕΥΤΑΙΑ ΝΕΑ

ΔΙΑΒΑΣΤΕ ΠΕΡΙΣΣΟΤΕΡΑ
ΕΞΥΠΝΗ ΠΛΟΗΓΗΣΗ